mgi dnbseq t1 sequencer (Complete Genomics Inc)
Complete Genomics Inc is a verified supplier 
Complete Genomics Inc manufactures this product 
99
Structured Review
Complete Genomics Inc
mgi dnbseq t1 sequencer
Mgi Dnbseq T1 Sequencer, supplied by Complete Genomics Inc, used in various techniques. Bioz Stars score: 99/100, based on 102 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mgi+dnbseq+t1+sequencer/DNBSEQ-T1%2B/pm41735337-47-7-7
Average 99 stars, based on 102 article reviews
Mgi Dnbseq T1 Sequencer, supplied by Complete Genomics Inc, used in various techniques. Bioz Stars score: 99/100, based on 102 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mgi+dnbseq+t1+sequencer/DNBSEQ-T1%2B/pm41735337-47-7-7
Average 99 stars, based on 102 article reviews
mgi dnbseq t1 sequencer - by Bioz Stars,
2026-09
99/100 stars
Images
Related Articles
Purification:Article Title: An organ-wide spatiotemporal transcriptomic and cellular atlas of the regenerating zebrafish heart Article Snippet: Sequencing libraries were prepared with PCR products undergoing the following steps: concentration quantification (QubitTM dsDNA Assay Kit, Thermo, Q32854), DNA fragmentation (in-house Tn5 transposase at 55 °C for 10 minutes), PCR amplification (KAPA HiFi Hotstart Ready Mix (Roche, KK2602) with 0.3 μM Stereo-seq-Library-F primer (/5phos/CTGCTGACGTACTGAGAGG*C*A) and 0.3 μM Stereo-seq-Library-R primer (GAGACGTTCTCGACTCAGCAGA) and purification (Vazyme, N411-03). .. The purified PCR products were used to construct DNB libraries and sequenced on an Article Title: 4D Single-Cell Spatial Transcriptomics Reveals Dynamic Morphogenetic Gradients and Regenerative Domains in Planarians Article Snippet: PCR products were used to prepare sequencing libraries, with the following steps: quantification of concentration using the QubitTM dsDNA Assay Kit (Thermo, Q32854), DNA fragmentation with in-house Tn5 transposase at 55 °C for 10 minutes, PCR amplification (KAPA HiFi Hotstart Ready Mix, Roche, KK2602) with 0.8 μM cDNA-PCR primers, and purification using Vazyme (N411-03). .. The purified PCR products were used to construct DNB libraries and sequenced on an Article Title: An organ-wide spatiotemporal transcriptomic and cellular atlas of the regenerating zebrafish heart. Article Snippet: Sequencing libraries were prepared with PCR products undergoing the following steps: concentration quantification (QubitTM dsDNA Assay Kit, Thermo, Q32854), DNA fragmentation (in-house Tn5 transposase at 55 °C for 10minutes), PCR amplification (KAPA HiFi Hotstart ReadyMix (Roche, KK2602) with 0.3μM Stereo-seq-Library-F primer (/5phos/ CTGCTGACGTACTGAGAGG*C*A) and 0.3μM Stereo-seq-Library-R primer (GAGACGTTCTCGACTCAGCAGA) and purification (Vazyme, N411-03). .. The purified PCR products were used to construct DNB libraries and sequenced on an Polymerase Chain Reaction:Article Title: An organ-wide spatiotemporal transcriptomic and cellular atlas of the regenerating zebrafish heart Article Snippet: Sequencing libraries were prepared with PCR products undergoing the following steps: concentration quantification (QubitTM dsDNA Assay Kit, Thermo, Q32854), DNA fragmentation (in-house Tn5 transposase at 55 °C for 10 minutes), PCR amplification (KAPA HiFi Hotstart Ready Mix (Roche, KK2602) with 0.3 μM Stereo-seq-Library-F primer (/5phos/CTGCTGACGTACTGAGAGG*C*A) and 0.3 μM Stereo-seq-Library-R primer (GAGACGTTCTCGACTCAGCAGA) and purification (Vazyme, N411-03). .. The purified PCR products were used to construct DNB libraries and sequenced on an Article Title: 4D Single-Cell Spatial Transcriptomics Reveals Dynamic Morphogenetic Gradients and Regenerative Domains in Planarians Article Snippet: PCR products were used to prepare sequencing libraries, with the following steps: quantification of concentration using the QubitTM dsDNA Assay Kit (Thermo, Q32854), DNA fragmentation with in-house Tn5 transposase at 55 °C for 10 minutes, PCR amplification (KAPA HiFi Hotstart Ready Mix, Roche, KK2602) with 0.8 μM cDNA-PCR primers, and purification using Vazyme (N411-03). .. The purified PCR products were used to construct DNB libraries and sequenced on an Article Title: An organ-wide spatiotemporal transcriptomic and cellular atlas of the regenerating zebrafish heart. Article Snippet: Sequencing libraries were prepared with PCR products undergoing the following steps: concentration quantification (QubitTM dsDNA Assay Kit, Thermo, Q32854), DNA fragmentation (in-house Tn5 transposase at 55 °C for 10minutes), PCR amplification (KAPA HiFi Hotstart ReadyMix (Roche, KK2602) with 0.3μM Stereo-seq-Library-F primer (/5phos/ CTGCTGACGTACTGAGAGG*C*A) and 0.3μM Stereo-seq-Library-R primer (GAGACGTTCTCGACTCAGCAGA) and purification (Vazyme, N411-03). .. The purified PCR products were used to construct DNB libraries and sequenced on an Construct:Article Title: An organ-wide spatiotemporal transcriptomic and cellular atlas of the regenerating zebrafish heart Article Snippet: Sequencing libraries were prepared with PCR products undergoing the following steps: concentration quantification (QubitTM dsDNA Assay Kit, Thermo, Q32854), DNA fragmentation (in-house Tn5 transposase at 55 °C for 10 minutes), PCR amplification (KAPA HiFi Hotstart Ready Mix (Roche, KK2602) with 0.3 μM Stereo-seq-Library-F primer (/5phos/CTGCTGACGTACTGAGAGG*C*A) and 0.3 μM Stereo-seq-Library-R primer (GAGACGTTCTCGACTCAGCAGA) and purification (Vazyme, N411-03). .. The purified PCR products were used to construct DNB libraries and sequenced on an Article Title: 4D Single-Cell Spatial Transcriptomics Reveals Dynamic Morphogenetic Gradients and Regenerative Domains in Planarians Article Snippet: PCR products were used to prepare sequencing libraries, with the following steps: quantification of concentration using the QubitTM dsDNA Assay Kit (Thermo, Q32854), DNA fragmentation with in-house Tn5 transposase at 55 °C for 10 minutes, PCR amplification (KAPA HiFi Hotstart Ready Mix, Roche, KK2602) with 0.8 μM cDNA-PCR primers, and purification using Vazyme (N411-03). .. The purified PCR products were used to construct DNB libraries and sequenced on an Article Title: An organ-wide spatiotemporal transcriptomic and cellular atlas of the regenerating zebrafish heart. Article Snippet: Sequencing libraries were prepared with PCR products undergoing the following steps: concentration quantification (QubitTM dsDNA Assay Kit, Thermo, Q32854), DNA fragmentation (in-house Tn5 transposase at 55 °C for 10minutes), PCR amplification (KAPA HiFi Hotstart ReadyMix (Roche, KK2602) with 0.3μM Stereo-seq-Library-F primer (/5phos/ CTGCTGACGTACTGAGAGG*C*A) and 0.3μM Stereo-seq-Library-R primer (GAGACGTTCTCGACTCAGCAGA) and purification (Vazyme, N411-03). .. The purified PCR products were used to construct DNB libraries and sequenced on an Sequencing:Article Title: A spatial transcriptomics comparison of the adult versus metamorphosed axolotl brain Article Snippet: .. Raw sequencing data were generated using an Article Title: Divergent stem cell mechanisms govern the primary body axis and appendage regeneration in the axolotl Article Snippet: .. Stereo-seq sequencing files were generated from Article Title: A spatial transcriptomics comparison of the adult versus metamorphosed axolotl brain. Article Snippet: .. Raw sequencing data were generated using an Generated:Article Title: A spatial transcriptomics comparison of the adult versus metamorphosed axolotl brain Article Snippet: .. Raw sequencing data were generated using an Article Title: Divergent stem cell mechanisms govern the primary body axis and appendage regeneration in the axolotl Article Snippet: .. Stereo-seq sequencing files were generated from Article Title: A spatial transcriptomics comparison of the adult versus metamorphosed axolotl brain. Article Snippet: .. Raw sequencing data were generated using an |